Spiral

Kitano pulled his chair to the center of the cell, directly under the camera, and grabbed the page on which he had written. Then he stepped onto the chair and held up the paper so the image filled the screen.

“Shit. He knows about the camera,” Robbins said.

Dunne barely heard him. He was transfixed by the message.

I CAN TELL YOU WHO SHE IS

31

VLAD GLAZMAN TYPED AS HARPO READ OFF THE SEQUENCE from the gel. The two had finished the second round of PCR and dielectrophoresis a half-hour ago, and were recording the genetic sequence of the glowing fungus. Harpo read off the bands, calling out a sequence of A’s, C’s, T’s, and G’s that Vlad dutifully transcribed.

Harpo halted, took a great big sigh.

“That’s it?” Vlad asked.

“That’s it.”

Vlad stared at the string of letters:

GACTCGACTAGCTAGCAATTACTGATCAGCATT

TTSCCCAATGCAGCATTTTCGACTGACCCGACT

CGACTAGCTAGCAATTACTGATCAGCATTTTSC

CCAATGCAGCATTTTCGAGCAAATCAGACTCG

ACTAGCTAGCAATTACTGATCAGCATTTTSCCC

AATGCAGCATTTTCGAGACTCGACTAGCTAGCA

ATTACTGATCAGCATTTTSCCCAATGCAGCAT TTTCGA…

It ran on for three pages.

“Run it through the translator.”

Vlad hit a sequence of keys, shipping the data to a simple script translator called BabelGene, which rendered it in alphanumeric form. Each three-letter codon corresponded to a letter of the alphabet, AAA for “a,” ACA for “b,” and so on. Connor had been the one that had originally proposed the standard.

BabelGene did its job, and the screen filled with text.

The Uzumaki is an extraordinarily dangerous weaponized version of the species known as Fusarium spirale. It is highly virulent, spreading by spores that can survive in human, avian, and agricultural hosts…

“Christ,” Harpo said.

Vlad barely heard him, stunned as he read paragraph after paragraph detailing everything Connor had learned about the Uzumaki and everything he had done to try to defeat it. Not only that, but Connor said that he had one of the Uzumaki cylinders. Included in the message were the GPS coordinates of the location where it was hidden.

“Shit,” Vlad said. “Double shit.”

Vlad pushed Print. A LaserJet next to the computer fired up, spitting out a sheet of yellow paper with Connor’s revelations. Harpo grabbed the printout. “We should send this to someone.

Now. CDC. FBI. CIA. Someone.”

Vlad flipped his cellphone open. He hit Jake’s number. It rang once, then clicked off.

He tried it again. Same result.

He checked the bars. Plenty of signal. So what was wrong?

Then he heard a pop, felt a splash of liquid on his cheek.

Vlad turned.

Harpo was falling, the back of his head gone.

JAKE HEARD TWO SHOTS, THEN A QUICK BURST OF FOUR more. He pulled at the cuffs, trying desperately to get loose. He was in the passenger’s seat of the FedEx van, held by a ring and chain welded to the floorboard. Maggie and Dylan were tied up in the back. A strap of flesh-colored tape covered his mouth.

The cuffs holding him were virtually indestructible, brushed stainless steel with a rubberized lining and connected by a flexible band made from some kind of reinforced plastic. His bones would break before the cuffs would.

He watched Harpo’s house, alert for any movement inside. Then another gunshot. Jake yanked with his arms, trying to pull loose the ring in the floor, but it was no use.

Jake saw movement. Vlad shuffled around the corner of the house, dragging his right leg behind him. He looked to be badly hurt, hopping forward, holding a yellow printout in his hand. He looked desperate, focusing on his goal, each hop deepening his grimace.

Jake tried to yell. Tried to warn him.

He had no idea Orchid was right behind him.

“VLADIMIR,” ORCHID SAID, AND WAITED FOR HIM TO TURN.

She put the first bullet in his neck, just above the Adam’s apple. His mouth formed an O, but no sound came out. He went down straightaway, no fuss, gurgling and spitting up blood.

She stood over him. The yellow printout was still in his grasp, jittering with the firing of his dying nerves.

She knelt, put the silencer directly to his temple, and put in a second bullet to finish it.

She waited until he was still, then pried the printout from his fingers.

She stood. Her own hands were shaking. This was it. Success or failure.

She read the message. By the fourth paragraph, she knew the answer.

She glanced up. Jake was staring at her, hate in his eyes.

No matter. He would be dead soon.

Orchid folded the sheet of paper carefully and tucked it in a pocket. Within hours she would have the Uzumaki. Within days it would be done. Kitano would be dead, the Uzumaki would be free, and she would have all the money. She did something she hadn’t done in a long time.

Orchid smiled.

32